Dataset for CDS Unclassified of organism all

[Download (right click)]

12 sequence(s)

>gnl|bcl2dbcds|A0A0E3T8T5_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Bovine papular stomatitis virus (length=534 residues).
atgatcggtgacaggcatcgcgacgataccgacatcgacgccagcgccgtcgtggccgcgtatctcgccagcgagtacgc
caacgcagtcatcgacaacctctctgactccgaacgcgtggcgctggaggcattgcgcgcctccggagacgaggtacgcc
accccatgctgcaggagctgacaaacgccggcggcaatcacgcgaacccggagacctcgcacattccggccaccctcatt
tcagcactacttgaagcaccagcctcccccggccgcatggtgacggccatcgagctctgcgcgcagatgggccggcggtg
gacgcgccggttccagttcctcaacttcatgcggctcgtacacgtcctcgtggatcgcatgccgcctacggcctccgagg
accttgccgtctggctcgaacgcgccgcgcgcgtccagtcggcgcgtcagcgcatgtcccgcgtcgccggtctcggcatg
ttcctcgccggttgcggcattctgttcgctggagccagattcctccgtcggtga
>gnl|bcl2dbcds|A0A0E3XB25_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Bovine papular stomatitis virus (length=534 residues).
atgatcgatgacaggcatcgcgacgataccgacatcgacgccagcgccgtcgtggccgcgtatctcgccagcgagtacgc
caacgcggtcatcggcaacctttcggatgccgaacgcgtggcgctggaggcattgcgggcctccggagacgaggtacgct
accccatgctgcaggagctgacaaacgccggcggcaatcacgcgaacccggagacctcgcacattccggccaccctcatt
tcagcactacttgaagcaccagcctcccccggccgcatggtgacggccatcgagctctgcgcgcagatgggccggcggtg
gacgcgccggttccagttcctcaacttcatgcggctcgtacacgtcctcgtggatcgcatgccgcctacggcctccgagg
accttgccgtctggctcgaacgcgcagcgcgcgtccaggcgatgcgtcatcgcatgtcccgcgtcgccggtctcggcatg
ttcctcgccggttgcggcattctgttcgttggagccagattcctccgtcggtga
>gnl|bcl2dbcds|A0A2S1GHL1_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Canarypox virus (length=528 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagtc
gctgcatttataattacgtcattagcagttattaacttgtttttgtag
>gnl|bcl2dbcds|Q6VZT9_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Canarypox virus (length=528 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagtc
gctgcatttataattacgtcattagcagttattaacttgtttttgtag
>gnl|bcl2dbcds|A0A2H4X256_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Flamingopox virus FGPVKD09 (length=528 residues).
atggctagtagtactatgaaagatgaaacttattatatcgctctgaatatgatacagaactatattatagaatatagcac
agataaatcaagaaaagattttgtaatagattccgtatcctatgatattcttaaggcagcttgtgaaatggtaataaaaa
ataattacaatgaatttgataaatttatttctaagaatatagattttaatgctataataactcaagcaatagaagataaa
attaattggggtagaataataactattattgccttttgcgcatattattctaaaaaagttaaacaagacacgtcatcgtc
gtactacgatgaactaatatcagaaactataactgacgctatactatctagatatagatcttggtttataaaacaagatt
attggaatggcattcatatatataaaaactatacgtacatctttaatacagctacatattgtgtttttacagcttcgtta
gttattgcttcactagcagtttttaaaatatgctctttttatatctaa
>gnl|bcl2dbcds|A0A0A7MEW5_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Parapoxvirus red deer/HL953 (length=519 residues).
atggccggtgagcacaatgtcgacagcagtgccgtcatggccgcctaccttgcgcgcgagtatgcgtatgccatcgagtc
gcagctctcggccgcggagcgtcgcgcgctcgaggcgctgcgcggagcctgcgcggaagtgagattcccgctctcgcgcg
agttagttgccgccgggtccgcgtacgccgcgccggaggcggatcacgtgccgtcggcgctggtggccgcgctgctggag
acgcccgcctcgcccgggcgcatcgtcaccgcgaccgagctgtgcgcgcagatgggccgcatctggacgcgcggcgcgcg
cgtgctgggcttcctgcggctgctctgcgtgctagcggaccgcatgccggcgaccgccgaccaggacctcggcggctggc
tggtgcgcgttgcgcaggtgcgcgccgcgcgccgacgcgtgacccggctggccgggatcggggtcgtgctcgcgggctgc
ggaatcgtcgtgctaggcgcgcgcatgctgcggcggtga
>gnl|bcl2dbcds|A0A068EHE4_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Penguinpox virus (length=528 residues).
atggctagtagtactatgaaagatgaaacttattatatcgctctgaatatgatacagaactatattatagaatatagcac
agataaaccaagaaaagattttgtaatagattcagtatcctatgatattcttaagacagcttgtgaaatggtaataaaaa
ataaatataatgaatttgataaatttatttctaagaatatagattttaatgctataataactcaagcaatagaagataaa
attaattggggtagaataataactattattgccttttgcgcatattattctaaaaaatttaatcaagacacgccttcatc
gtactacgatgaaataatatcagaaactataactgatgctatactatctagacatagatcttggtttataaaacaagatt
attggaatggaattcatatatataaaaactatacgtacatctttaataaagctacatattgtatttttacagcttcgtta
gttattagttcactagcagtttttaaaatatgctctttttatatctaa
>gnl|bcl2dbcds|A0A068EE18_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Pigeonpox virus (length=528 residues).
atggctagtagtactatgaaagacgaaacttattatatcgctctgaatatgatacagaactatattatagaatatagaac
agataaaccaagaagagattttgtaatagattccgcatcctatgatatccttaagacagcttgtgaaatggtaataaaaa
ataattataatgaatttgataaatttatttctaagaatatagattttaatgctataataactcaagcaatagaagataaa
attaattggggtagaataataactattattgccttttgcgcatattattctaaaaaagttaaacaagacacgtcatcatc
ataccatgatgaactaatatcagaaactataactgactctatactatctagatatagatcttggtttataaaacaagatt
attggaatggcattcatatatataaacactatatgtacatctttaacacagctacatattgtatttttacagcttcgtta
gttattgcttcactagcagtttttaaaatatgctctttttatatctaa
>gnl|bcl2dbcds|A0A1Z3GCP4_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Seal parapoxvirus (length=525 residues).
atggccaaccgaaacaacagcatcgacaccggtgctgttatggcagcgtacctcgcaagtgagtacgcagctgctgtcga
agctaacctcacactgcaggagcgcgctgcgctagaggctctccgcgtctctgctgccgaagttcgctctccgctgcttt
tcgagctcgcaaacgccggcgataactttgttcagccagagaacagccatgtgcctgcagcgctgatatctgcgctgctc
gaagcgcccacttctcctggccgcgtagtaacggctactgagctgtgcgcgcaaatgggccgccggtgggtgcgcggtcg
ccgattcttagactttatgcgcctagtgcacgtgttcgttgaccgcatgccgccctctgccagcgaagacattggcaggt
ggctgtgcaacgctgcgcgtgcgcgcgcggcgcggcgccgagttgtgcgcactgctgggctcagcgttattgcggctggc
tgcgctgcagtggctctcggggtttggctgctcagacgaaggtag
>gnl|bcl2dbcds|A0A1V0QG20_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Shearwaterpox virus (length=543 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagcc
gctgcatttataattacgtcattagcagttattaacttgttttttgtagaatcacataattga
>gnl|bcl2dbcds|A0A1V0S7R2_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Shearwaterpox virus (length=525 residues).
atggagatgcaaaaagatgaaacttattataccgtattagatattattcaaaattattttatagagtatctaactaataa
aaatagacaagattttgtagctgatgaacgagcttatgttataataaaagatatgtgtaaccgtattataaaaagagata
tagaattactaatgaaagatgttaaatatgataacttagaagacaaaataccgaaaatagttaatgatactataggtgat
aagattacgtggggaagaatagctagcgtaatagctttcggagcgtacagtactaacatttttaaaaaagaaggaaaaga
tgatttagtagataatatgcctgatacaataacaggactaatattggatatatgcagagactggatggtagagcaagatt
gttggaacggcttttataactctattttacttaaagaaaagtttggttatattatttcttgcactagaatagccgcattc
gtaattacatcattagcaatagctaatctttttattaaaatataa
>gnl|bcl2dbcds|A0A0M3ZJZ2_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Turkeypox virus (length=549 residues).
atggatagcactcgggtggtgataaaagacgagagttattacatattattagatataatacaaaattacttggaagaata
tagtacgggatgtgataggattaattttgtacataatgaaagtgcttataccatgcttaatagaatatgttcttctgtga
taactactaataaaacaacatttgatgagataatagacaaatatgatatagaagaaataataaaagatatatatttaacc
ttatataacagtcttaattggggacagataatagcatcggtttctttcggagcttatctctctaaggtaatagtggaaaa
gtatcctaatgatacagattatgttagacgtgtatcagaaactataacagaagcgatattagctaatgacaaggattggt
tcactaaccaaggttattggaagggtatatttaaatttgacatgcttactgagttattcaaaataaccaaatatacatta
tgttccgcatctgtaataattacatgcatggcatctatgaaaatattatccagtttttttaaaatataa
© 1998-2018