Dataset for CDS Unclassified of organism Shearwaterpox virus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A1V0QG20_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Shearwaterpox virus (length=543 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagcc
gctgcatttataattacgtcattagcagttattaacttgttttttgtagaatcacataattga
>gnl|bcl2dbcds|A0A1V0S7R2_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Shearwaterpox virus (length=525 residues).
atggagatgcaaaaagatgaaacttattataccgtattagatattattcaaaattattttatagagtatctaactaataa
aaatagacaagattttgtagctgatgaacgagcttatgttataataaaagatatgtgtaaccgtattataaaaagagata
tagaattactaatgaaagatgttaaatatgataacttagaagacaaaataccgaaaatagttaatgatactataggtgat
aagattacgtggggaagaatagctagcgtaatagctttcggagcgtacagtactaacatttttaaaaaagaaggaaaaga
tgatttagtagataatatgcctgatacaataacaggactaatattggatatatgcagagactggatggtagagcaagatt
gttggaacggcttttataactctattttacttaaagaaaagtttggttatattatttcttgcactagaatagccgcattc
gtaattacatcattagcaatagctaatctttttattaaaatataa
© 1998-2018