Dataset for CDS Unclassified of organism Seal parapoxvirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1Z3GCP4_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Seal parapoxvirus (length=525 residues).
atggccaaccgaaacaacagcatcgacaccggtgctgttatggcagcgtacctcgcaagtgagtacgcagctgctgtcga
agctaacctcacactgcaggagcgcgctgcgctagaggctctccgcgtctctgctgccgaagttcgctctccgctgcttt
tcgagctcgcaaacgccggcgataactttgttcagccagagaacagccatgtgcctgcagcgctgatatctgcgctgctc
gaagcgcccacttctcctggccgcgtagtaacggctactgagctgtgcgcgcaaatgggccgccggtgggtgcgcggtcg
ccgattcttagactttatgcgcctagtgcacgtgttcgttgaccgcatgccgccctctgccagcgaagacattggcaggt
ggctgtgcaacgctgcgcgtgcgcgcgcggcgcggcgccgagttgtgcgcactgctgggctcagcgttattgcggctggc
tgcgctgcagtggctctcggggtttggctgctcagacgaaggtag
© 1998-2018