Dataset for CDS ORFV125 of organism Pseudocowpox virus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|D3IZD7_ORFV125-01 ORFV125 gene OS=[Viruses] Pseudocowpox virus GN=ORFV125 (length=522 residues).
atggcaaacagaaacgaaatcgactcctccgccgtcgtggccgcctacctcgcggggcagtacgcggccgcggtagagga
gcagctgacgccgcgcgagcgcgaggcactcgaggcccttcgcatctccggcgacgaggtccggtccccgctgctgcagg
agctctccaacgccggcgactaccgcgcgaacccggagtcctcacacatccccgccgccctcgtctccgcactgcttgaa
gcccccacctcccccggccgcatggtcaccgcggtcgagctctgcgcgcagatgggccgtctctggacgcgcggccgacg
gctcatcgacttcgtgcggctcgtacacgtgctcttcgaccgcatgccgtccacggccaacgacgacctcgccgcctggc
tgcagaccgtcgcgcgcgtgcaccggtcgcggcgctggctgcaccgctctataggcgtcggcaccgtaatggcgggcgtg
ggcctgctcttccttggcgtgcgcgtgctgcgtcgcacttaa
>gnl|bcl2dbcds|D3IZF4_ORFV125-01 ORFV125 gene OS=[Viruses] Pseudocowpox virus GN=ORFV125 (length=522 residues).
atggcaaacagaaacgacatcgactcctccgccgtcgtggccgcctacctcgcggggcagtacgcggccgcggtcgagga
gcagctgacgccgcgcgagcgcgaggcgctcgcggcccttcgcatctccggcgacgaggtccggtccccgctgctgcggg
agctctccaacgccggcgactaccgcgcgaaccccgagaactcgcacatccccgccgccctcgtctccgcgctgctcgaa
gcccccacctcccccggccgcatggtcaccgcggtcgagctctgcgcgcagatgggccgtctctggacgcgcggccgccg
gctcatcgacttcatgcggctcgtgcacgtgctcttcgaccgcatgccgtccacggccaacgacgacctcgccgcctggc
tgcagaccgtcgcgcgcgtgcaccggtcgcggcgctggctgcaccgctctataggtgtcggtaccgtaatggcgggcgtg
ggcctgctgttcctcggcgtgcgcgtgctgcgccgcacttaa
© 1998-2018