Dataset for CDS Unclassified of organism Parapoxvirus red deer HL953

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0A7MEW5_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Parapoxvirus red deer/HL953 (length=519 residues).
atggccggtgagcacaatgtcgacagcagtgccgtcatggccgcctaccttgcgcgcgagtatgcgtatgccatcgagtc
gcagctctcggccgcggagcgtcgcgcgctcgaggcgctgcgcggagcctgcgcggaagtgagattcccgctctcgcgcg
agttagttgccgccgggtccgcgtacgccgcgccggaggcggatcacgtgccgtcggcgctggtggccgcgctgctggag
acgcccgcctcgcccgggcgcatcgtcaccgcgaccgagctgtgcgcgcagatgggccgcatctggacgcgcggcgcgcg
cgtgctgggcttcctgcggctgctctgcgtgctagcggaccgcatgccggcgaccgccgaccaggacctcggcggctggc
tggtgcgcgttgcgcaggtgcgcgccgcgcgccgacgcgtgacccggctggccgggatcggggtcgtgctcgcgggctgc
ggaatcgtcgtgctaggcgcgcgcatgctgcggcggtga
© 1998-2018