Dataset for CDS ORFV125 of organism Orf virus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A0F6N236_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagaagagattgacgcttccgccgtcatggctgcctacctcgcgagagagtacgcggcggcggtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtatccgcgcttctcgaa
gcccccacctcccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgggtatggacgcgcggccgcaa
gctcgtcgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggctgacgaggacctcagcgcctggc
tgcaggccgtcgcgcgcgtacacggcacgcggcgccgcctgcaccgcgttctcggcgtcggggccgtcatggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|A0A0R8HLA0_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagacgacattgacgcctccgccgttatggctgcctacctcgcgagagagtacgcggaggctgtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gcccccacctcccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccggctatggacgcgcggccgccg
gctcgtcgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|A0A0R8HV90_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagacgacattgacgcctccgccgtcatggctgcctacctcgcgagagagtacgcggaggctgtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gctcccacctcccccggccgcatggtcaccgcggttgagctctgcgcgcagatgggccggctatggacgcgcggccgcca
gctcgtcgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|A0A0R8I4U2_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagacgaaattgacgcctccgccgtcatggctgcctacctcgcgagagagtacgcggaggctgtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gctcccacttcccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccgactatggacgcgcggccgcca
gctcgtcgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|A0A1D8RAA0_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagaagagattgacgcctccgccgttatggctgcctacctcgcgagagagtacgcggaggctgtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccctgaaaactcgcacattcccgccgccctcgtctccgcgcttctcgag
gcccccacctcccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccggctatggacgcgcggccgcca
gctcgttgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|F1AXH8_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagaagaaattgacgcctctgccgtcatggctgcctacctcgcgagagagtacgcggtggctgtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gcccccacctcccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccggctatggacgcgcggccacaa
gctcgttgacttcatgcggctcgtgtacgtgctcctaaaccgtctgccgcccacggccgacgaggacctcagcgcctggc
tgcaggccgtcgcgcgagtgcacggcacgcggcgccgcctgcaccgcgttctcggcgtcggggccgtcgtggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|Q6TVJ5_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagacgacattgacgcctccgccgttatggctgcctacctcgcgagagagtacgcggaggctgtagagga
acagctgacgctgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcaccaaccctgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
acccccacatcccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccggctatggacgcgcggccgcca
gctcgtcgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacagccgacgaggacctcggcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|Q6TVX5_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagaagagattgacgcctccgccgtcatggctgcctacctcgcgagagagtacgcggcggctgtagaaga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gcccccacttcccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgggtatggacgcgcggccgccg
gctcgtcgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcagcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgttctcggcgtcggggccgtcatggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|Q80G30_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagaagagattgacgcctccgccgtcatggctgcctacctcgcgagagagtacgcggcggctgtagaaga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gcccccacctcccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgggtatggacgcgcggccgcca
gctcgtcgaattcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcagcacctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgttctcggcgtcggggccgtcatggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
>gnl|bcl2dbcds|W6EVU4_ORFV125-01 ORFV125 gene OS=[Viruses] Orf virus GN=ORFV125 (length=522 residues).
atggcaaacagagaagagattgacgcctccgccgttatggctgcctacctcgcgagagagtacgcggaggctgtagagga
acagctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccgctgctgcaag
aactctcgaacgcgggcgagcaccgcgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttctcgaa
gcccccacctcccccggccgcatggtcactgcggttgagctctgtgcgcagatgggccggctatggacgcgcggccgcca
gctcgttgacttcatgcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgaggacctcagcgcctggc
tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgttctcggcgtcggggctgtcatggcaggcgtc
ggtatgctgctgctcggcgtgcgcgtgttgcggcgcacataa
© 1998-2018