Dataset for CDS Unclassified of organism Fowlpox virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3G3CB29_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Fowlpox virus (length=546 residues).
atggatacagacgttaatagtagaaaagatgaaacttattatataattttaaatattatacaaaattactttatagaata
ctacagcggtaagagtagacaatgtttcgtagaagatcagagagcttatactatagtaaaggatacgtgtgaattaatta
taaaaaaatactttattgatctacaaaaaattgtagctaaatataatagtgatataggaagtaaatttccagaaatagta
tctaatactatacaagataagataacatggggtagaataatgagtataatagcttttggagcgtatattactaaagtatt
taaagaacaaggaaatgatgatttagtatatagaatgcctgatatagtaacagaatcacttttaatcaagtgtagaactt
ggataataagtcaggattattggaatggtttacataaatatgtttctgatcatgaaaaatttagttatttaacctattcc
attaaagcagcagcatttattattacatctctagcaatagctaattttttttataaatacatataa
© 1998-2019