Dataset for CDS Unclassified of organism Flamingopox virus FGPVKD09

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2H4X256_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Flamingopox virus FGPVKD09 (length=528 residues).
atggctagtagtactatgaaagatgaaacttattatatcgctctgaatatgatacagaactatattatagaatatagcac
agataaatcaagaaaagattttgtaatagattccgtatcctatgatattcttaaggcagcttgtgaaatggtaataaaaa
ataattacaatgaatttgataaatttatttctaagaatatagattttaatgctataataactcaagcaatagaagataaa
attaattggggtagaataataactattattgccttttgcgcatattattctaaaaaagttaaacaagacacgtcatcgtc
gtactacgatgaactaatatcagaaactataactgacgctatactatctagatatagatcttggtttataaaacaagatt
attggaatggcattcatatatataaaaactatacgtacatctttaatacagctacatattgtgtttttacagcttcgtta
gttattgcttcactagcagtttttaaaatatgctctttttatatctaa
© 1998-2018