Dataset for CDS Unclassified of organism Canarypox virus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A2S1GHL1_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Canarypox virus (length=528 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagtc
gctgcatttataattacgtcattagcagttattaacttgtttttgtag
>gnl|bcl2dbcds|Q6VZT9_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Canarypox virus (length=528 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagtc
gctgcatttataattacgtcattagcagttattaacttgtttttgtag
© 1998-2018