Dataset for CDS Unclassified of organism Bovine papular stomatitis virus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A0E3T8T5_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Bovine papular stomatitis virus (length=534 residues).
atgatcggtgacaggcatcgcgacgataccgacatcgacgccagcgccgtcgtggccgcgtatctcgccagcgagtacgc
caacgcagtcatcgacaacctctctgactccgaacgcgtggcgctggaggcattgcgcgcctccggagacgaggtacgcc
accccatgctgcaggagctgacaaacgccggcggcaatcacgcgaacccggagacctcgcacattccggccaccctcatt
tcagcactacttgaagcaccagcctcccccggccgcatggtgacggccatcgagctctgcgcgcagatgggccggcggtg
gacgcgccggttccagttcctcaacttcatgcggctcgtacacgtcctcgtggatcgcatgccgcctacggcctccgagg
accttgccgtctggctcgaacgcgccgcgcgcgtccagtcggcgcgtcagcgcatgtcccgcgtcgccggtctcggcatg
ttcctcgccggttgcggcattctgttcgctggagccagattcctccgtcggtga
>gnl|bcl2dbcds|A0A0E3XB25_uncORFV125-01 Putative ORFV125 gene OS=[Viruses] Bovine papular stomatitis virus (length=534 residues).
atgatcgatgacaggcatcgcgacgataccgacatcgacgccagcgccgtcgtggccgcgtatctcgccagcgagtacgc
caacgcggtcatcggcaacctttcggatgccgaacgcgtggcgctggaggcattgcgggcctccggagacgaggtacgct
accccatgctgcaggagctgacaaacgccggcggcaatcacgcgaacccggagacctcgcacattccggccaccctcatt
tcagcactacttgaagcaccagcctcccccggccgcatggtgacggccatcgagctctgcgcgcagatgggccggcggtg
gacgcgccggttccagttcctcaacttcatgcggctcgtacacgtcctcgtggatcgcatgccgcctacggcctccgagg
accttgccgtctggctcgaacgcgcagcgcgcgtccaggcgatgcgtcatcgcatgtcccgcgtcgccggtctcggcatg
ttcctcgccggttgcggcattctgttcgttggagccagattcctccgtcggtga
© 1998-2018