Dataset for CDS ORFV125 of organism Bovine papular stomatitis virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q6TV64_ORFV125-01 ORFV125 gene OS=[Viruses] Bovine papular stomatitis virus GN=ORFV125 (length=534 residues).
atgatcggtgacaggcatcgcgacgataccgacatcgacgccagcgccgtcgtgaccgcgtatctcgccagcgagtacgc
caacgcggtcatcgacaacctttcggatgccgaacgcgtggcgctggaggcattgcgcgcctccggagacgaggtacgcc
accccatgctgcaggagctgacaaacgccggcggcaatcacgcgaacccggagacctcgcacattccggccaccctcatt
tcagcactacttgaagcaccagcctcccccggccgcatggtgacggccatcgagctctgcgcgcagatgggccggcggtg
gacgcgccggttccagttcctcaacttcatgcggctcgtacacgtcctcgtggatcgcatgccgcctacggcctccgagg
acctcgccgtctggctcgaacgcgcagcgcgcgtccaggcgacgcgtcatcgcatgtcccgcgtcgccggtctcggcatg
ttcctcgccggttgcggcattctgttcgttggagccagattcctccgtcggtga
© 1998-2018