Dataset for CDS 070L of organism all

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q677S5_070L-01 070L gene OS=[Viruses] Lymphocystis disease virus - isolate China GN=070L (length=525 residues).
atgatgagcaacaaatttgaaaccgatacaaaatatcttattgatgcattttttaaagaatattttaattcacaagaaag
taatgatataattttaaaaactataaaaaaagaggtaaatattttatttgataaacatagacttgtttattctaatatga
taaatgatatatctattactactgaaatagatattttagttaaaaaaactgctgaaagtatattttctgatggtttagtt
aattggggtagaataattagtttaattacctttggaattttaatcgttgaatatttaaaaacaataaataatactgataa
aataacatctgtaagtactattatttcctcatatttaatagaacatcagaagcattggttaataaaaaataatgcatgga
taggattggttgatttttttactgttcaaacttatacatcacccgttaaatctttacttaccttttttatagtttttatg
ggtacaggagctatgttatattcagcttttaatttaacttattga
© 1998-2018