Dataset for CDS 097R of organism Zoo ranavirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q8UH03_097R-01 097R gene OS=[Viruses] Zoo ranavirus GN=097R (length=426 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
agtagacaacaaggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgtgtttatgcacatctgcaggtacatcgtcaggatctttccgtcc
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagcgatcgcgggagtgatcgctggag
tggtcctgtctctcttgttctcttga
© 1998-2019