Dataset for CDS iridoviridae of organism Soft shelled turtle iridovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C3RWV2_097R-01 097R gene OS=[Viruses] Soft-shelled turtle iridovirus GN=097R (length=414 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
agtagacaacagggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtcc
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
tcttgttctattga
© 1998-2018