Dataset for CDS Unclassified of organism Short finned eel ranavirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A192GNS8_unc097R-01 Putative 097R gene OS=[Viruses] Short-finned eel ranavirus (length=414 residues).
atggacgtgaggcaatttctgtcagactgcgaagctcctgaggagatggtggccctgagggccgccgctgacgcagtggg
ggtagacaacagggcctgcgcccacctgtacaccatgctgtgggaaggtgtcaacctggaggaggttcacgtctccctcc
tgggagacggcgttgtaaactggggcagggtggcagcgtttatgcacatctgcaggtacacagtaaggacctttccgtct
agcatggataggacagaggccgctctgactaaatttatacaggacccagagatagacgagaacctcagagagtggacaga
tagactgggtaccgtcagggcgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
tcttgttctcttga
© 1998-2018