Dataset for CDS 097R of organism Rana grylio iridovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H9XFR8_097R-01 097R gene OS=[Viruses] Rana grylio iridovirus GN=097R (length=414 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
agtagacaacagggcctgcgcccacctatacaccatgctgtgggaaggcgtcagcctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtcc
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
tcttgttctattga
© 1998-2018