Dataset for CDS iridoviridae of organism Rana catesbeiana virus 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A223PJ87_097R-01 097R gene OS=[Viruses] Rana catesbeiana virus 2 GN=097R (length=414 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctatctc
tcttgttctattga
© 1998-2018