Dataset for CDS Unclassified of organism Lymphocystis disease virus Sa

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1B2RW88_unc070L-01 Putative 070L gene OS=[Viruses] Lymphocystis disease virus Sa (length=537 residues).
atgtacatatcagcaccaatgagcgataaattagaaatcgatacaaaaaaactaatcgactcaattttcaacaattctgt
tgaaaatgaggatgagactttaaaggttatgaaaagggagataaatttgttattcgataaacatcgacgcgtttactcga
atatgatcgacgaaatatcatcttccaaattggggataagtgctgttatggaagatacgatcaaaaaagtattttcagac
ggttcaattaattggggtagaatagtcagtttaattacgttcggcgttttagtcgccgattatttaaaaacaaacgacgg
agagcatgaaatagttgctgtaaaagattccatttcttcatatttaataaatcatcaaaaagaatggttactaaaaaata
acgcttggaaaggattcgtagattttttccaagttacaagtaatttaccgtcgattaaatcatcgcttaccgtatttata
gctttaataagtttcggagcggttttgtattctttttttaatttaacaactttttaa
© 1998-2018