Dataset for CDS 097R of organism Lumpfish ranavirus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q9T2R6_097R-01 097R gene OS=[Viruses] Lumpfish ranavirus GN=097R (length=444 residues).
atggacgtgaggcaatttctgtcagactgtgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagtgcctgcgcacacctgtacaccatgcattgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggtagggtggccgtgtttatgcacgtctgcaggtacaccgtcaggacctttccgtct
agcatggataggacagaggttgcgctgactaaatttatacaggacccaaaaatatacaagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
tggtcctgtctctcctgtctctcctgtctctcttgttctcttga
>gnl|bcl2dbcds|A0A3Q9T8U5_097R-01 097R gene OS=[Viruses] Lumpfish ranavirus GN=097R (length=426 residues).
atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcctgcgcacacctgtacaccatgcagtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggtagggtggccgtgtttatgcacatctgcaggtacaccgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatatacaagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
tggtcctgtctctcttgttctcttga
© 1998-2019