Dataset for CDS iridoviridae of organism Common midwife toad virus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A0A0VDG1_097R-01 097R gene OS=[Viruses] Common midwife toad virus GN=097R (length=438 residues).
atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcatgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
tgatcactggagtggtcctgtctctcttgttctcttga
>gnl|bcl2dbcds|A0A2D0XKG8_097R-01 097R gene OS=[Viruses] Common midwife toad virus GN=097R (length=426 residues).
atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcatgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
tggtcctgtctctcttgttctcttga
>gnl|bcl2dbcds|A0A2D0XMC5_097R-01 097R gene OS=[Viruses] Common midwife toad virus GN=097R (length=426 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcagggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
tggtcctgtctctcttgttctcttga
>gnl|bcl2dbcds|H6WEE3_097R-01 097R gene OS=[Viruses] Common midwife toad virus GN=097R (length=414 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcaggatggccgcgtttatgcacatctgcagatacatcgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
tcttgttctcttga
© 1998-2018