Dataset for CDS 097R of organism Bohle iridovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A192GQ13_097R-01 097R gene OS=[Viruses] Bohle iridovirus GN=097R (length=426 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
agtagacaacaaggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgtgtttatgcacatctgcaggtacatcgtcaggacctttccgtcc
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagcgatcgcgggagtgatcgctggag
tggtcctgtctctcttgttctcttga
© 1998-2018