Dataset for CDS Unclassified of organism Amphilophus citrinellus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q0T8Z8_unc070L-01 Putative 070L gene OS=[Eukaryota] Amphilophus citrinellus (length=729 residues).
atgtatgctgtccagggttattttgtgctttgtggtaaaaagtactgcctaatttgtgcctgtcaagagggtgagcagca
tccagctgcttgcactgacatgacgtgtaaagtcatggacattgtgaatatgcagctgtacatcccgccagagcctcctc
ttttgttcatgggtgacaccaaacatttgttgaaccaaggtctagagctcgatggcacttcgatccttcaactggatcca
gactttactgtgcttggtgacaatgccaacatggttcacctttacaacacaatagacactcaccagtgttttacgtgtac
cctttcactcaaggactttgttcagggtgacaccttcttgggtgaacatatttatcacgtatacaacaacggaattgaat
tgttggacaaacacagatctacctatgaagcgatgatcacacagctacctgaggtagacgaacaattgatcattcgacta
gcaagttttttatttgacgacggaatcgtaaactggggccggattgtcagtttcatagcatttgcagccgtggcatctca
aatgtcacacctgtgcaaagaagactggtacgtgactggaataggcagagcagtagccaattacctaacggaacgacact
tagactggctggtcgcaaatggttcatgggtaagggaaggtgtttgcgttacggttagtgtaatcatcttacttcataag
gtgacttga
© 1998-2019