Dataset for CDS iridoviridae of organism Ambystoma tigrinum virus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A0U2QBA9_097R-01 097R gene OS=[Viruses] Ambystoma tigrinum virus GN=097R (length=414 residues).
atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacatggcctgtgcccacctgtacaccatgctgtgggaaggcatcaacctggaggaggttcacgcatccttcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacaccgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatatacaagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttaaaatggttgggagcgggagtgatcactggagtggtcctgtctc
ttttgttctcttga
>gnl|bcl2dbcds|A0A0U2QHX4_097R-01 097R gene OS=[Viruses] Ambystoma tigrinum virus GN=097R (length=414 residues).
atggacgtgaggcaatttctgttagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacatggcctgtgcccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccttcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacaccgtcaggacctttccgtct
agcatggataggacagaggttgctttgactaaatttatacaggacccaaagatatacaagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttaaagtggttgggagcgggagtgatcactggagtggtcctgtctc
ttttgttctcttga
>gnl|bcl2dbcds|A0A0U2R7T3_097R-01 097R gene OS=[Viruses] Ambystoma tigrinum virus GN=097R (length=414 residues).
atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacatggcctgtgcccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccttcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacaccgtcaggacctttccgtct
agcatggataggacagaggttgctttgactaaatttatacaggacccaaagatatacaagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttaaagtggttgggagcgggagtgatcactggagtggtcctgtctc
ttttgttctcttga
© 1998-2018