Dataset for CDS 097R of organism Ambystoma tigrinum stebbensi virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q6YH32_097R-01 097R gene OS=[Viruses] Ambystoma tigrinum stebbensi virus GN=097R (length=414 residues).
atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacatggcctgtgcccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccttcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacaccgtcaggacctttccgtct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatatacaagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttaaagtggttgggagcgggagtgatcactggagtggtcctgtctc
ttttgttctcttga
© 1998-2018