Dataset for CDS vNR13 of organism all

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|Q90343_vNR13-01 vNR13 gene OS=[Eukaryota] Coturnix japonica GN=vNR13 (length=534 residues).
atgccgggctctctgaaggaggagacggcgctgctgctggaggattacttccagcaccgggccggcggggccgcgctgcc
tcccagcgccacggcggccgagctgcggcgggcggcggccgagctggagcgacgggagcggcccttcttccgatcctgcg
ctccgctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtggcggcgcagctggagaccgacggcggc
ctgaactggggccggctgctggcgctcgtggtgttcgccggcacgttggcggcagcgctggccgagagcgcctgcgagga
agggccgagccgcctggccgccgcgctgaccgcgtacctggccgaggagcagggagagtggatggaggagcacggcggat
gggatggcttctgtcgcttcttcggcagacatggctcccaaccagctgaccagaacagtaccttaagcaatgctatcatg
gcagcagcagggtttggaatagcaggattagcttttctcttggtggtgcggtag
>gnl|bcl2dbcds|H3ALX7_vNR13-01 vNR13 gene OS=[Eukaryota] Latimeria chalumnae GN=vNR13 (length=537 residues).
atgtgcgattcgttgaaagaggaaacccgactcttggctaacgatttcatccagttttgcctcggcagcggccggactgc
ccccaaccctgcagcccgggtcctgcgcagggtgacagcggaactggagcggcagaaccaggcgctcttcgactcgtttc
aggggaactgtgggccggaggccgagctcggctcggtgctgaagagggtggctgagcagctggaggccgaaggcggcttg
aactgggggagggtggtgagtttatttgccttcgcgggctgcttggctaaaggggtccagcgggcccagaatgaggagtg
tgcgatgggagcctgctgtgggaagttggctgaagctctggttaactacctggccaaggaaagaggggactggctggagg
agaatggaggctgggatggattctacaaattttttgaaagaagtgatcattaccaggagtccactgtacgaaatgcttta
atggcagcagctgggtttggaatagcaggtttagccttcctgttagctgtgcgataa
>gnl|bcl2dbcds|Q9E1F2_vNR13-01 vNR13 gene OS=[Viruses] Meleagrid herpesvirus 1 GN=vNR13 (length=540 residues).
atggctgactccctgaaggaagaaacggcgttgctgctggaggattacttccagcactgctgcggcaaggaagggccgcc
gccgagtcctacggcggcagagctgcggcgagcggcggccgagctggagcggcgagagaggcccttctttcgctcctgcg
cgccgttagcgagcggcggcacgcaggcagcgttgtcggcgctgcaaagtgtggtgtctgaattgaactccggaagcggc
ttcaactggggtcgatgcctggcgaccatagtcctcggcggctcgctggcaacggcgctgtacgaaaacggctgtgagga
agggccaagccgcttggccgcagcgctggccgcgtacctggccgaagagcagggcgagtggttgcgggagcacggcggat
gggacggattctgtcgcttcttcgcccgttttggtcctgggctgggagaggcgagtcaaaccttccctcttggtctcatc
gtcgctgcagccggaatcgggataacggttctcatcgtcgtgtggcaattccaatcctaa
>gnl|bcl2dbcds|Q9E1F2_vNR13-02 vNR13 gene OS=[Viruses] Meleagrid herpesvirus 1 GN=vNR13 (length=489 residues).
atggctgactccctgaaggaagaaacggcgttgctgctggaggattacttccagcactgctgcggcaaggaagggccgcc
gccgagtcctacggcggcagagctgcggcgagcggcggccgagctggagcggcgagagaggcccttctttcgctcctgcg
cgccgttagcgagcggcggcacgcaggcagcgttgtcggcgctgcaaagtgtggtgtctgaattgaactccggaagcggc
ttcaactggggtcgatgcctggcgaccatagtcctcggcggctcgctggcaacggcgctgtacgaaaacggctgtgagga
agggccaagccgcttggccgcagcgctggccgcgtacctggccgaagagcagggcgagtggttgcgggagcacggcggat
gggtaagcacggcacgggcgggcatgagcggctcgtttgggtcgccggtgtctgccagaagcgaggagcaccgtgcgcgg
cgctggtag
© 1998-2018