Dataset for CDS Unclassified of organism all

[Download (right click)]

22 sequence(s)

>gnl|bcl2dbcds|A0A068AAN3_uncA9-01 Putative A9 gene OS=[Viruses] Alcelaphine gammaherpesvirus 2 (length=498 residues).
atgggggaacctgagtttcaagacaatgtgctttattatttatttctcgatgaacttaattttgtgttaataaggaatgg
attttcctgcagccatgcgaagttgatcatggatgaaactcgaaaaagggtcacggactacagtgaacaatttgaggtga
ttagcaaggccgtagaacccccagaaccagagtcgctaggcaggattgcagcgtctctcctcacccccaatcccaactgg
ggtcgattggtggctttttttgcctacctggcttatttgcagaggaattcttcacacaaagtttttacaaaaaaccacat
aaagcaattaaaaaaaatagttaagaaacatgttgtaccttggaattcagatttaaaaggcagcaaagcgaaactacctg
cacctcgccaacctttaaagtctacgctcctgttaaccgcagcagcttcttgcctcactttttttctcatctatttccga
tccatcagagcaaagtga
>gnl|bcl2dbcds|W5LAB6_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Astyanax mexicanus (length=531 residues).
atgtcctgttggttaaggaaagagactctggcgctggcggaggactacatccgcttctgcaccggggaccaacggacgcc
ccccagcgagtcggccgaggccatgcgccgcctggccaaagagatggagcggcaacaccattctaaattccactcgctgt
cccagagcttcctgacggcctgcggcgcagaccccagcgcgtgcctccggagcgtcatggccgtgctggtggaggacggg
aagctgaactggggcagagttgtgtcgctgtttacattcacaggcgttctggccactgaactattctctagaggagacgg
gccggagtgctgcagcaggttagcagagactatagctgactacctgggagcagagaacaaagaatggctgctggaaaatg
aaggctgggagggattctgtaagttcgtccgcagagcgggacatctaggtcaagattcctccatgaaaacagcactgttt
gctgcggcaggagtcgggatagctggactgacctttctcctcgtgcgctga
>gnl|bcl2dbcds|Q9YTQ0_uncVBCL2-01 Putative V-BCL-2 gene OS=[Viruses] Ateline herpesvirus 3 (length=525 residues).
atgtatattcacagtagtagctgttatgacatatcaaaaaaaatgtcaagcattacctttcaaaaaactattgaaagcat
actaaatgagtgtcaagaatgccatagtcagtctgactcaattgtaagagctatacattctgttatacaacaatataata
aatttgaagacttaatgcctgatttttctatatgtgcacatgacagaattaagtttgttggagaagcaataatgcttacc
acgaagcacaacacaaattggggaaaagttgtagcaatgatctctttctccgttgctgcactacaaactattgatgaaga
ctatagacgtgttgcaacttcaacattatcatcctacatagctaaaagtgtaggagtcaactggtttattgatcatggag
gcaaaaagggactggtagagttttgtgatactattctgtctaagagtaatgttacgttttcagtgttcttgttacctgct
atacttactgtaattattctaattggaactttattaataaaataa
>gnl|bcl2dbcds|A0A060CXQ6_uncA9-01 Putative A9 gene OS=[Viruses] Bovine gammaherpesvirus 6 (length=522 residues).
atgcagtttaaagacattgaagctggccgggttgaagaagaccgtactgaagaaacagatgaagcgggctgctccgatat
ttttatccaccagctcaagctggccttaataaaaggcggcataaagtacatatacgccaactggattattgatacagcta
aagagaagagcgcccaattaattgaaaagtttgacagcctgagcaaggatgtagagtttagcactccggatgatctgaaa
ctcgtcctcaactctatgtttgaagacggagtcaaccttggaagggttactgtgtttttcgcttatgtgatatacctgca
cttaaagttggaggactgcagcttcccagatgcccactacactgtaattaaggaaaccatggacacctacattattccct
ggctgcaaacaaacatttccagcattaaggaaatgtcctcgtctattgctaacgtatttgcaaccctggttgctcctatt
gctttgggaattgcatctatgtttctattccaaaagggctaa
>gnl|bcl2dbcds|Q993L0_uncBALF1-01 Putative BALF1 gene OS=[Viruses] Callitrichine gammaherpesvirus 3 (length=522 residues).
atgaccgacgacgtgtttcaggacaatgcacctaaccttggggccgaggatgaaatggaccggggtgtcctgctacttac
tagggtcatgatagcggcatacctcgatgatccgggtaaaggcttgggcacggaggagcgtctctttctacgtctaatca
aacgcctaatgaagaaggaggaaaaaagattcgctgatatagtgaacagtggttcagcgcctaccacactccacggacac
atcaaacgcctgatgacatttaccagggcaatctacgaggatcacatggataattggtttcgtgtcagagcactcacgag
tttagccgttgcctacgcacgaagaaacatacctggggattcagagaatgccggacttttgttagtgggctttgcagaat
tcctatgtctatatcggagggcatggctttctcgactcgggggcatacgtgtgggattgagacgtgcttttcctctgacc
tggatgcgcatgcgagtcggagagagttgttacaaacaataa
>gnl|bcl2dbcds|E9M5Q5_uncM11-01 Putative M11 gene OS=[Viruses] Cricetid gammaherpesvirus 2 (length=519 residues).
atggacaatctgacagagtggcgatcccttctgaaagtgtttctgcttaaatcaagtgggtgtagctgtcaaggcgtgtc
agctggtttgttggcggatgtggatgttttggacaaactcactacagattttataactaagtatgaatcggtgtatggaa
aattgcccctgactcagtcagattgggtaaacaatataactgctttgttattttttatgttggacaagataaactttggg
agatttattggtttgtttgctgttggcaaatttgtgtgtcaggaactgctgctgtcctctaccacatggtctatggcaca
tgacctgctttttcataaactggccctggtattggaagtaaagattatgccatggttgaccagcatgggcgtgggcacct
ttaatgagttgctaggaagacacgcgggacaagttgttcaaacaagattcttttattttttaaaatcaatgtttgtatgg
gcatgtatgcagttgttggatccatggccttttacctaa
>gnl|bcl2dbcds|Q8UWD5_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Danio rerio (length=531 residues).
atgtcctgttggttgagggaacagactctgttgctggcggaggactacatcagcttctgcagtgggatccaacagacgcc
tcccagcgagtcggcggaggccatgaggtacctggccaaagaaatggagcagcagcacagaaccaaattccgatcccttt
cccaggagttcctggacacctgcggagcagatcccagcaaatgtctgcagagcgtcatgagagaactggtgggagatggg
aaaatgaactggggaagggtggtctctatcttcacattcactggagtgctggccagtgaactactgtccaggggagagaa
ttcggagggttcccgaagattggccgagactatagcagactacctaggaggagaaaaacaggactggctggtggaaaacg
gaggctgggagggtttttgcaggtttttccacaacgcaagacaactgaaccaggagtcctccatgaaaacagcactgttt
gcagcagcaggagtgggtttagctggtctaaccttcctcttagtacgctga
>gnl|bcl2dbcds|A0A0B6VHH4_uncBHRF1-01 Putative BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus (length=297 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttggattcatcaac
agggcggctggtctacattaattgaagacaacattcctggatccagaaggtttagctggactttgtttcttgctggactg
actttgagtctgttagttatatgtagttatttatttatctccagaggaagacactaa
>gnl|bcl2dbcds|Q804D0_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Gallus gallus (length=534 residues).
atgccgggctctctgaaggaggagacggcgctgctgctggaggactacttccagcaccgcgccggcggcgccgcgctgcc
tcccagcgccacggcggccgagctgcggcgggcggcggccgagctggagcgccgagagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtggcggcgcagctggaggccgaaggcggc
ctcaactggggccggctgctggcgctcgtggtgttcaccggcacgctggcggcggcgctggccgagagcggctgcgagga
agggccgagccgcctggccgccgcgctggccgcgtacctggccgaggagcagggcgagtggcttgaggagcacgcgcgat
gggacggcttctgtcgcttcttcggcagacatggctcccaaccagctgaccagaacagtaccttaagcaatgccatcatg
gcagcggcagggtttggaatagcaggattagcttttctcttggtggtgcggtag
>gnl|bcl2dbcds|Q90ZN1_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Gallus gallus (length=534 residues).
atgccgggctctctgaaggaggagacggcgctgctgctggaggactacttccagcaccgcgccggcggcgccgcgctgcc
tcccagcgccacggcggccgagctgcggcgggcggcggccgagctggagcgccgagagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtggcggcgcagctggaggccgaaggcggc
ctcaactggggccggctgctggcgctcgtggtgttcaccggcacgctggcggcggcgctggccgagagcggctgcgagga
agggccgagccgcctggccgccgcgctggccgcgtacctggccgaggagcagggcgagtggctggaggagcacggcggat
gggacggcttctgtcgcttcttcggcagacatggctcccaaccagctgaccagaacagtaccttaagcaatgccatcatg
gcagcggcagggtttggaatagcaggattagcttttctcttggtggtgcggtag
>gnl|bcl2dbcds|A0A0N9SCW9_uncORF16-01 Putative ORF16 gene OS=[Viruses] Human herpesvirus 8 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcatgtggattaaacgaacctgagta
tctgtaccatcctttgctcagccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggctaatgtgagatttcacagcaccaccggtataaaccagcttgggttgagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactaacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgttattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgaccaggagatga
>gnl|bcl2dbcds|A0A0N9SEY2_uncORF16-01 Putative ORF16 gene OS=[Viruses] Human herpesvirus 8 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcctgtggattaaacgaacctgagta
tctgtaccatcctttgctcaaccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggcgaatgtgagatttcacagcaccaccggtataaaccagcttgggttaagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactaacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgttattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgaccaggagatga
>gnl|bcl2dbcds|W5N753_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Lepisosteus oculatus (length=1593 residues).
atgtgtgaccaaacgtttctcgccatcaacttcgggccgtgtgacaaatgtcaaaagacaaagcccctgatgaatatata
catcaaatcggagccgatcaactactgcgcgctctgcgtggagctgatggctaccgaggggctgcaggagagtgagaccc
tggcatccttgaaaaacgagtcggagaccctgaagtcaaagctggaagaggagagagccaagctgcacgatgttgaacta
caccaggtggcggaccgggtggaggcgctgggtcagtttgtgatgaagaccaggcggaccctgaagggccacggaaacaa
agtgctgtgcatggactggtgtaaagacaagagaaggatcgtgagctcttcccaggatggaaaagtaattgtatgggatg
ctttcacaaccaacaaggaacatgcagtcaccatgccatgcacctgggtaatggcttgtgcgtacgcaccctctggctgt
gcagtagcctgtggaggtttggacaacaagtgttcagtgtatccattgacttttgacaagaatgagaacatggcttcaaa
gaagaagtctgtggcaatgcataccaactacttgtcagcctgcagcttcaccaactctgacatgcagatcctgacagcca
gtggagatggcacctgtgctctgtgggatgtggagagtggacagctgctccagagtttccacggccacgccgccgacgtg
ctctctctggacctggcgccgtcagagacgggcaacaccttcgtgtccgggggttgtgataagaaggccatggtctggga
cctgcgctctggacagtgcatccagtcctttgaaacacatgagtctgacattaacagcgtcagatactatcccagtggag
atgcatttgcatcaggttctgatgatgctacttgtcgtctgtacgatcttcgagcagacagagaagtagcaatttactcc
aaagaaagcatcatttttggagcttcaagcgtggacttttcacttagtggacgtctgctgtttgcaggatacaatgatta
cactattaatgtctgggatgtcctgaagggcaccagggtctccattctctttggtcatgagaatcgggttagcacattgc
gagtttcaccggatggcacagccttctgctctggatcatgggatcatactctgaggaaaatgagctgctgtttgagggaa
cagaccttgattctggctcgggattacatcgacctctgcctggggacgacccgccagtctcccagcccaaacgccgaagc
gatgcgcagtctggccaaggagatggagaagcagtaccagtccaaatttaactccctcctgcacagtttcatcgcgacgt
gcggacccgaccccagcgttaacttgaagaaggtcatggaggaactggtcggagacgggattttaaactgggggagggtg
gtttctctcttcaccttcacaggactgctggcacgccagctgtacgccgaaggagcgagtattgactgttttaagagact
ggccgaaacaattgctgactacctcggaggtgaaaaacgagaatggctgatacagaatgaaggatgggtaagt
>gnl|bcl2dbcds|A0A0S0DWX8_uncBALF1-01 Putative BALF1 gene OS=[Viruses] Lymphocryptovirus Macaca/pfe-lcl-E3 (length=549 residues).
atgcagccagccaagtctaccgattcggtgtttgtgaggaccccggtcgaggcgtgggtctccccctcgcccccggacga
caaagtggcggaaaccagctacctcctgttcagggccatgtacgccgtgttcacccaggacgagacggacctgcctctac
cggccctggtcatgtgccggctcctgaaagcctccctgaggaagcacaggagaatgtacgcggagctggcctgcaagacg
gccgacctcgggggcaagcacgcgcacatgcagctcatcatcagcgtgctgagagccgtgtacgatgaccattacgacta
ctggtcgcggctcagggtggtgctgtgctacacggtggtgtttgcggtgcgcaactacctggatgaccacgacagcgccg
ccttcgtgatgggggccaccgcccactacctcgccctctatcgcaggctctggtttgcgagtctgggcggcctgccaagg
gcgctgagacgtcagttccccgtgacgtggaccgtggccagcctgagcaccttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q53D42_uncORF16-01 Putative ORF16 gene OS=[Viruses] Macaca fuscata rhadinovirus (length=564 residues).
atggcggctattcagggccctccgccgctccctgaggaggaaaatgaaaattctttgccagatgacgtgtatgctataga
gggaatctttctttactgtgggcttggacaggcggagtacttgcaccatcccgtgtttagccctatcaaggaatttatca
gctcctttctcaaggacagcgcgcgcctttacgaaaggcttttgcgccacaccgattaccgctctttgcgcggactaaac
gccataggccaagggatgttgcatataaacacggacggacgccacaactggggtcgcgctttggccgtgttaggtcttgg
cgcctatgtggtggataaaattagagacgacgagcgtcttttaacgttcgctatagccgttctacccgtgtacgcgtacg
aggcgctggagtctcagtggtttcgttcgcacggcggatgggagggactccggaattactgcgagcgaatactgaggcat
cgccgcaatgcgaggagacacatgtgctacggggtcgcggctggtcttctggcgctagttgcgctgtttgccatcaggcg
atag
>gnl|bcl2dbcds|Q9WRT6_uncORF16-01 Putative ORF16 gene OS=[Viruses] Macaca mulatta rhadinovirus 17577 (length=564 residues).
atggcggctgttcagggccctccgccgccccctgaggaagaaaatgaaaattctttgccagttgacgtttatgctataga
gggcatctttctttactgtgggctcgggcaggcggagtacttgcaccatcccgtgtttagccctattaaggaatttatca
gcgcctttctcaaggacagcgctcgcctgtacgagaggctcttgcgccacaccgattaccgctctctgcggggactaaac
gccataggccaagggatgctgcaaataaacacggacggacgccacaactggggtcgcgctttggccgtgttgggtcttgg
tgcgtatgtggtggataaggttaaagacgacgagcgtcttttaacgttcgccatagccgttctacccgtgtacgcgtacg
aggcgctggagtctcagtggtttcgttcacacggcgaatgggagggactcaggaattactgcgagcgaatactgaggcat
cgccgcaacgcgaggagacacatgtgctacggagttgcggctggtcttctggcgctagtggcgctgtttgccatcaggcg
atag
>gnl|bcl2dbcds|A0A0B5CYR6_uncORF16-01 Putative ORF16 gene OS=[Viruses] Macaca nemestrina rhadinovirus 2 (length=555 residues).
atggaggctgttcgggccccgccgccggaggaagaaaatgacaattctttgccagatgacgtgtacgccatagagggcat
atttctttactgcgggctcggacaggcggaatacctgcaccatcccgtctttagtcccattaaggagtttattcgcgctt
ttcttaaggacagtgcgcggctgtacgagaggcttttgcgcaacatagactatcgctctatgcgtgggttaaacgccata
ggtcagggaatgctgcagataaatgcggacggacgccacaactggggtcgcgtcttagcggtgctgggtcttggcgcgta
cgttgtggaaaaggttatgaacgacgaacgtctgttaacgtttgccattgccgtgctgcccgtgtacgcgtacgaggcgt
tggagtctcagtggtttcgtctgcacggcggatgggagggcctgaggaattactgcgcgcggatactgaggcaccggcgc
aacgcaagacacatgtgctacggagtcgccgccggactgctggcgctggttgccctgtttgccatgagacgatag
>gnl|bcl2dbcds|C1BL36_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Osmerus mordax (length=561 residues).
atgtcgtgtaggctgtggaaggagacactggctctgggagaagactacctggctttctgctgtgcaagcccacggctagc
ccctccccctcccagcgagccggcggctgccatgagacgtctggcacaggacatggagaccctgaacagcgtctccttcc
aagccctttccaagaacctcctgtgccactctgaacaggacccctgtgccagcctgagggcagtgctgaaagagatagtt
gtagatggaaaactgaactggggaagggtagtgtgcatcttcacctttactggtgtgctggccagacagctacaagagca
gaagtcaaaggggcaggacattgggcaagggcctgacaaatgcagaggcttggctgaggcgatcgctgacttcctgggag
aggagaagaaagactggctgcaggaaaatggaggctgggaagggctttgtaagttttcagattgtgccagagggatgaac
caagactcctccatgaagacggccctgtttgctgttgctggcgtgggcattgcagggttaacctttctcctggggcgcta
g
>gnl|bcl2dbcds|U5NM37_uncORF16-01 Putative ORF16 gene OS=[Viruses] Retroperitoneal fibromatosis-associated herpesvirus (length=537 residues).
atgcaatctcggcaactgccgccagatgttgcggcgattgaggggattttacttgtgtgtggtttggaccggcccgaata
tgtgcatcatccagtgctgagtcctattcggacgtgtgtgtcgtacattgtgcgaactcgcgcggaggattttaatcaga
tgctggacgatgcgcgcatcgagagtgtggctggcctggcgcgcctgggacgagggatgttacacatgaacagggaaggt
ggaatgaattggggacgcgctttagctctgctggccttgggttgcacggcgattaggcgattgtcgcccaacaggcacct
aacggcgtttgctatgggcatgtttccgttgtatatgtatcaggccatcgggcctcagtggtttcgggcgcatgggggct
ggagtggatttaaaatctactgtgaacgctatacccaagaacaagaaaccctgcggttgctgttggttttcgccgcggtg
ggactggtggccgcagtgtctgcctgttgggttgcttaccggcgcggttcttggtga
>gnl|bcl2dbcds|Q77NK4_uncORF16-01 Putative ORF16 gene OS=[Viruses] Rhesus monkey rhadinovirus H26-95 (length=564 residues).
atggcggctgttcagggccctccgccgccccctgaggaagaaaatgaaaattctttgccagttgacgtttatgctataga
gggcatctttctttactgtgggctcgggcaggcggagtacttgcaccatcccgtgtttagccctattaaggaatttatca
gcgcctttctcaaggacagcgctcgcctgtacgagaggctcttgcgccacaccgattaccgctctctgcggggactaaac
gccataggccaagggatgctgcaaataaacacggacggacgccacaactggggtcgcgctttggccgtgttgggtcttgg
tgcgtatgtggtggataaggttaaagacgacgagcgtcttttaacgttcgccatagccgttctacccgtgtacgcgtacg
aggcgctggagtctcagtggtttcgttcacacggcgaatgggagggactcaggaattactgcgagcgaatactgaggcat
cgccgcaacgcgaggagacacatgtgctacggagttgcggctggtcttctggcgctagtggcgctgtttgccatcaggcg
atag
>gnl|bcl2dbcds|O40636_uncORF16-01 Putative ORF16 gene OS=[Viruses] Saimiriine herpesvirus 2 (length=483 residues).
atgtcaagtattagatttcaaaacattgttgaaaatatactaaataagtgccaagacaacaaacattcacaagactcagt
tgtgagagctatacactcagttatacaccagtataacaagtttgaagctttaatgcctgatttttctttatgcgtacatg
atagacttaagtttactggagaagctatcttgctaactactgagcatactacaaattggggaaaagttgtagctatgctt
tcattttcagctgctgtgttgcaaactattgatgaagaatataaatgcgttgcaacttcaatgttatcgtcatatatagc
tagaagtgttggagcaaattggtttatggaaaatggaggtgaaaaaagcttagttaagttctgtaacagcattatgccta
aaaatccttttaatgttttaaattttttagttcctgctgtgttagctgggtttgtgttaatacaaactttattgataaaa
taa
>gnl|bcl2dbcds|Q01001_uncORF16-01 Putative ORF16 gene OS=[Viruses] Saimiriine herpesvirus 2 (length=483 residues).
atgtcaagtatcaaatttcagaacatcattgaaaatatactaaaaaagtgccaagacaacagacattcacaagactcagt
tgtgagagctgtacactcagttatacaccagtataacaagtttgaagctttaatgcctgatttttctttatgcgtacatg
atagaattaagtttactggagaagcaatcttgctaactactgagcatactacaaattgggggaaagttgtagctatgctt
tcattttcagctgctgtgttgcaaactattgatgaagaatataaatgtgttgcgacttcaatgttatcctcatatatatc
tagaagtgttggagcaaattggtttatagaaaatggaggtgagaaaagcctagttgagttctgtaacagcatcatgcctc
aaaatccttttaatgttttgaattttttagttcctgctgtgttagccgggcttgtgctaatgcaaactttattgataaaa
taa
© 1998-2018