Dataset for CDS ORF16 of organism all

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|P90504_ORF16-01 ORF16 gene OS=[Viruses] Human herpesvirus 8 type M GN=ORF16 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcctgtggattaaacgaacctgagta
cctgtaccatcctttgctcagccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggctaatgtgagatttcacagcaccaccggtataaaccagcttgggttgagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactgacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgctattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgagcaggagataa
>gnl|bcl2dbcds|F5HGJ3_ORF16-01 ORF16 gene OS=[Viruses] Human herpesvirus 8 type P GN=ORF16 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcctgtggattaaacgaacctgagta
cctgtaccatcctttgctcagccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggctaatgtgagatttcacagcaccaccggtataaaccagcttgggttgagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactgacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgctattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgagcaggagataa
>gnl|bcl2dbcds|Q76RI8_ORF16-01 ORF16 gene OS=[Viruses] Human herpesvirus 8 GN=ORF16 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcctgtggattaaacgaacctgagta
cctgtaccatcctttgctcagccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggctaatgtgagatttcacagcaccaccggtataaaccagcttgggttgagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactgacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgctattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgagcaggagataa
© 1998-2018