Dataset for CDS BALF1 of organism all

[Download (right click)] [Alignment] [Repertoires]

57 sequence(s)

>gnl|bcl2dbcds|Q99F66_BALF1-01 BALF1 gene OS=[Viruses] Cercopithecine herpesvirus 12 GN=BALF1 (length=549 residues).
atgaaggccgccaagtctacagattcggtgtttgtgaggaccccggtcgaggcgtgggtctcgccttccccgcccgacga
caaggtcgcggagaccagctacctcctttttagggccatgtacgcggtgttcacccaggacgagactgacctgcccaccc
cagctcaggtcctgtgccggctcatcaaggcctccctcagaaaggacaagaaactgtacgcggagctggcctgcaagacg
gcggacattggaggcaagcacgcccacgtgcagctcatcatcagcatcctgcgcgccgtgtacgacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacgcggttgtgtttgcggtgcgaaactacctggatgaccacgagagtgccg
ccttcgtgctgggggccaccgcccactacctggccctctatcgccgtgtctggtttgccaggattggcggcctgcccagg
tcgctgagacgccaattccctgtaacatgggctatcgccagcctgtcggacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A075FCZ0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgaaacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A075FFB0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaggctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0A8IKW4_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcagagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7T546_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtgtacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcattgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7T5J4_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatagcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7T8J1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggatcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TJ32_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgaatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TLW1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggacctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TPI3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TUX3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggcaagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TV67_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatagcccactacctggccctctatcgcagaatctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0S2YQW9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccatcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0U3U737_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcggggacaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0U3UKR9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgaactggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcaggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A1P7TZL6_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MM94_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcattgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MQV1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MTH2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcatcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggcaagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MU91_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
tagggagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MV59_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgcccttgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MXY9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactttcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
accctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MZQ8_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattactctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N1Z2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaaccgggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacacggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N2H2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaaccgggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A385J7X7_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgccagggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A385J8K7_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaaaacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A385JAB4_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagatgctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtatgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A385JB67_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggcncancaaggccnccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagtttcccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A3R5WKR1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagacagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A3R5WNA2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagactacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A3R5WYW3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
cagggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A410I1F1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaagaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A410I9N0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtggaccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A410J0D8_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgtgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6QMD2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacaa
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6QN24_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctatacgcagagctcgcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagttgtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaata
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6QXN1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacagctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6R4T3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtggatcgcgccctcgacgccagacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6R8J3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaagccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6R8R0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccagggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgggtgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6RBY3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgatgcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6RC31_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcggttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6RE52_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgtcgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6RFR1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgtgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A4D6TWI9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggacn
gccgacatcgggggcaangacacgcacgtacggctcatcatcagcgtcctgcgcgcattgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|K9UT94_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|P0CK58_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|P0CK59_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q91HV2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagatgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|U5YUM6_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaagaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcagagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2D1LYV4_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagatgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MP06_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A3R5WV36_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
taaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcatcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A3R5ZJV6_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccaaccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q91HI3_BALF1-01 BALF1 gene OS=[Viruses] Gorilline gammaherpesvirus 1 GN=BALF1 (length=549 residues).
atgaggccggccaagtctacagattccgtgtttgtgaggaccccagtagaggcgtgggtcgcgccatcgcctccggacga
caaggtggcggagtccagctacctcatgttcagggcaatgtacgcggtgttcacccaggatgagacgggcctgcctctgc
cagccatggtcctgtgccggctgattaaggcgtccctgaagaaggacaagaagctgtacgcggagctggcctgcaagacg
gcggatatcgggggcaagcacgcgcacgtgcagctcatcatcagcgtcctgcgcgccgtgtacgacgaccactacgacta
ctggtcgcgtctcagggtcgtgttgtgctacacggtggtgtttgcggtgcgaaactacctggatgaccacgagagcgcgg
ccttcgttctgggggccatcgcccactacctggccctgtaccggagactctggtttgcgaggatgggcggcatgccaagg
tcgctgagacgtcagttccccgtgagatgggcgctggctggcctgacttacttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q99F65_BALF1-01 BALF1 gene OS=[Viruses] Panine gammaherpesvirus 1 GN=BALF1 (length=549 residues).
atgaggccagccgagtctacagattccgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccgtcgccgccggacga
caaggtggccgagtccagctacctcatgttcagggcaatgtacgcggtgttctcccgggatgagtcggacctgccgctgc
cggccgcggtcctgtgccggctgatcaaggcctccctgaagaaggacagaaagctgtacgcggagctggcctgcaagacg
gcggacattgggggcaggcacgctcacgtccagctcatcaccagcgtcctgcgcgctgtgtacgacgaccactgcgacta
ctggtcgcgtctcagggtggtgctgtgctacacggtggtgtttgcggtgcgaaactacctggatgaccacagaagtgcag
ccttcgttctgggggccatcgcccactacctggccctgtaccgcagactctggtttgcgaggatgggcggcatgccaaga
tcgctgagacgccagttccccgtgacatgggcgatggccggcctgaccgacttcctgaaatctttgtaa
© 1998-2019