Dataset for CDS Unclassified of organism Saimiriine herpesvirus 2

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|O40636_uncORF16-01 Putative ORF16 gene OS=[Viruses] Saimiriine herpesvirus 2 (length=483 residues).
atgtcaagtattagatttcaaaacattgttgaaaatatactaaataagtgccaagacaacaaacattcacaagactcagt
tgtgagagctatacactcagttatacaccagtataacaagtttgaagctttaatgcctgatttttctttatgcgtacatg
atagacttaagtttactggagaagctatcttgctaactactgagcatactacaaattggggaaaagttgtagctatgctt
tcattttcagctgctgtgttgcaaactattgatgaagaatataaatgcgttgcaacttcaatgttatcgtcatatatagc
tagaagtgttggagcaaattggtttatggaaaatggaggtgaaaaaagcttagttaagttctgtaacagcattatgccta
aaaatccttttaatgttttaaattttttagttcctgctgtgttagctgggtttgtgttaatacaaactttattgataaaa
taa
>gnl|bcl2dbcds|Q01001_uncORF16-01 Putative ORF16 gene OS=[Viruses] Saimiriine herpesvirus 2 (length=483 residues).
atgtcaagtatcaaatttcagaacatcattgaaaatatactaaaaaagtgccaagacaacagacattcacaagactcagt
tgtgagagctgtacactcagttatacaccagtataacaagtttgaagctttaatgcctgatttttctttatgcgtacatg
atagaattaagtttactggagaagcaatcttgctaactactgagcatactacaaattgggggaaagttgtagctatgctt
tcattttcagctgctgtgttgcaaactattgatgaagaatataaatgtgttgcgacttcaatgttatcctcatatatatc
tagaagtgttggagcaaattggtttatagaaaatggaggtgagaaaagcctagttgagttctgtaacagcatcatgcctc
aaaatccttttaatgttttgaattttttagttcctgctgtgttagccgggcttgtgctaatgcaaactttattgataaaa
taa
© 1998-2018