Dataset for CDS Unclassified of organism Retroperitoneal fibromatosis associated herpesvirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U5NM37_uncORF16-01 Putative ORF16 gene OS=[Viruses] Retroperitoneal fibromatosis-associated herpesvirus (length=537 residues).
atgcaatctcggcaactgccgccagatgttgcggcgattgaggggattttacttgtgtgtggtttggaccggcccgaata
tgtgcatcatccagtgctgagtcctattcggacgtgtgtgtcgtacattgtgcgaactcgcgcggaggattttaatcaga
tgctggacgatgcgcgcatcgagagtgtggctggcctggcgcgcctgggacgagggatgttacacatgaacagggaaggt
ggaatgaattggggacgcgctttagctctgctggccttgggttgcacggcgattaggcgattgtcgcccaacaggcacct
aacggcgtttgctatgggcatgtttccgttgtatatgtatcaggccatcgggcctcagtggtttcgggcgcatgggggct
ggagtggatttaaaatctactgtgaacgctatacccaagaacaagaaaccctgcggttgctgttggttttcgccgcggtg
ggactggtggccgcagtgtctgcctgttgggttgcttaccggcgcggttcttggtga
© 1998-2018