Dataset for CDS Unclassified of organism Pygocentrus nattereri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B4EE08_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Pygocentrus nattereri (length=531 residues).
atgtcctgttggttaaggaaggagactctggtgctggcggaggactacattgacttttgcaccgggatccagcggacacc
tcccagcgagtcggccgaggccatgcggcacttggccaaagagatggagcggcagaaccacgtgaaatttctctcgatga
cgcaaggcttcctgtcggcttgcggctcggaccccagtgcgtatttacacagagtcatgaccgtgctggtggaggacgga
cagatgaactggggcagagtcgtgtccctctttacgtttacgggcgttctggccaccgaactgttctccagaggagaggg
gccagaggtctgtaggacactagcagagacgatagcagattacctgggaggagagaagaaagactggctggaggagaacg
agggctgggaggggttctgcaagttcgtgcgcagagctggacacgttacccaggactcctccatgaagacggcgctgttc
gccgccgcgggggtcgggttagctggactgacctttctcctagtgcgctga
© 1998-2019