Dataset for CDS Unclassified of organism Paramormyrops kingsleyae

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A3B3TEX4_uncvNR13-03 Putative vNR13 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=696 residues).
atggtaacggagacgcttatttatactgccggatgggagtcaatgctcatttcgtccttagataagaagatgggaatctt
aaaatttgcgtgtgcaactggagtggtcgctgctgccgcaggtgcagcgtacctctaccggcggttcaggagaacgccag
agcaggaggaagtgaatatggccacctcattgcaggatgaaactcttgtggtggcaaatgactatatggatttctgcatt
gggatcaagaggactcctcccagcgagttcgctaaagccatgcgatacatggcaaagaaggtggagaataagcataggtc
cagtctgcaccaacttgtggagacattctgcagatacggtggctttaacacctggaccaaactcaagaattttatgctgg
atgtgtttggtggtgaaagtacgagctggggcgagattctgattctctttgcctttgcgggaatactggcagttcaactg
tctaccacagatgaagatgtcgcctgtagcagacggctagcagagatgataagcgatgttcttgaagaaaaacaggaatg
gatgatccagaatggaggctggatggggttcatggactatgtccacacagtcaaaccaggatattcagagtcacctctga
agaaagctctccccgcagctgcaactgtggcaattgcctctcttcttgtacgttag
>gnl|bcl2dbcds|A0A3B3TEX4_uncvNR13-02 Putative vNR13 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=753 residues).
atgggaatcttaaaatttgcgtgtgcaactggagtggtcgctgctgccgcaggtgcagcgtacctctaccggcggttcag
gagaacgccagagcaggaggaagtgaatatggccacctcattgcaggatgaaactcttgtggtggcaaatgactatatgg
atttctgcattgggatcaagaggactcctcccagcgagttcgctaaagccatgcgatacatggcaaagaaggtggagaat
aagcataggtccagtctgcaccaacttgtggagacattctgcagatacggtggctttaacacctggaccaaactcaagaa
ttttatgctggatgtgtttggtggtgaaagtacgagctggggcgagattctgattctctttgcctttgcgggaatactgg
cagttcaactgtctaccacagatgaagatgtcgcctgtagcagacggctagcagagatgataagcgatgttcttgaagaa
aaacaggaatggatgatccagaatggaggctggatggggttcatggactatgtccacacagtcaaaccaggatattcaga
gtcacctctgaagaaagctctccccgcagctgcaactgtggcaattgcctctcttcttgtacaccggttatctactaaaa
agaaccctaccagacttgctcccatcttcattttcaatcctcaagaaactgccaggaacatcagtttgctagacgggaca
ttttaccagaaacatgcattatctgtcctgtaa
>gnl|bcl2dbcds|A0A3B3TEX4_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=600 residues).
atggccacctcattgcaggatgaaactcttgtggtggcaaatgactatatggatttctgcattgggatcaagaggactcc
tcccagcgagttcgctaaagccatgcgatacatggcaaagaaggtggagaataagcataggtccagtctgcaccaacttg
tggagacattctgcagatacggtggctttaacacctggaccaaactcaagaattttatgctggatgtgtttggtggtgaa
agtacgagctggggcgagattctgattctctttgcctttgcgggaatactggcagttcaactgtctaccacagatgaaga
tgtcgcctgtagcagacggctagcagagatgataagcgatgttcttgaagaaaaacaggaatggatgatccagaatggag
gctggatggggttcatggactatgtccacacagtcaaaccaggatattcagagtcacctctgaagaaagctctccccgca
gctgcaactgtggcaattgcctctcttcttaccggttatctactaaaaagaaccctaccagacttgctcccatcttcatt
ttcaatcctcaagaaactgccaggaacatcagtttgctag
>gnl|bcl2dbcds|A0A3B3TFS5_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=531 residues).
atgagcagctcattgcagaatgaaacccttatggtggcagatgattacatgaagttctgcatcggaatcagcagcacacc
tcccagtgagtcagctaaagcaatgcgatgcctggctaaggaggtggagagcagccagggtcccacactgcgtgctctag
tgcagacgttcctgattgcctgtggcgctgacccctggaccggtctgaggagcgtcatgctcgagctggttggagatgga
aggttgaactggggccgggtcatctcactctttgccttcacgggaatgctggcgagcgaactgtgttccaggggagaaga
tgtcagctgcagcagacgactagcggagatgatggtcgattttctcaatggagaaaaacaagaatggctgatccaaaatg
gaggctggggaggattcaccaattttgtccacactgcaagaccagcagatcaagattcatccatgagaaaagctctctac
gcagctgcaggcgtggggattgctgggataacctttctcctcgtacgctag
© 1998-2019