Dataset for CDS herpesviridae of organism Panine gammaherpesvirus 1

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|Q99F65_BALF1-01 BALF1 gene OS=[Viruses] Panine gammaherpesvirus 1 GN=BALF1 (length=549 residues).
atgaggccagccgagtctacagattccgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccgtcgccgccggacga
caaggtggccgagtccagctacctcatgttcagggcaatgtacgcggtgttctcccgggatgagtcggacctgccgctgc
cggccgcggtcctgtgccggctgatcaaggcctccctgaagaaggacagaaagctgtacgcggagctggcctgcaagacg
gcggacattgggggcaggcacgctcacgtccagctcatcaccagcgtcctgcgcgctgtgtacgacgaccactgcgacta
ctggtcgcgtctcagggtggtgctgtgctacacggtggtgtttgcggtgcgaaactacctggatgaccacagaagtgcag
ccttcgttctgggggccatcgcccactacctggccctgtaccgcagactctggtttgcgaggatgggcggcatgccaaga
tcgctgagacgccagttccccgtgacatgggcgatggccggcctgaccgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q9IHR2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Panine gammaherpesvirus 1 GN=BHRF1 (length=576 residues).
atggcctattcaacaagggatatactgttagccctgtgtatgcgggacagttacgtgcatggaaatggatctttgcatcc
tgtgttggagctagcagcaagagaaacacctcctcgcgtttccccagaagatactgtggttttgcggttacatttgttgc
ttgaggaggtaattcagcaaaatgcagaatcatttacaaacacttgggagacatttataacaaacgctgaacacgtggac
ctggattttgccgctgtatttgaagatatatttcaccgtggagatccatcccttgggcgagcgttggcctggctggcctg
gtgtatgcatgcctgcaggacattgtgcaggaaccagaacactccttactatgttgtggacctgtcagttcgtgggatgt
tggaagccagcgaaggcctggatgcttggattcatcaacagggtggctggactggtctaattaggagcgactctcttggc
tccacaaactctagatggactttgctttttgccggactgactttgagtctgttaattgtatgtagctatttatttatctc
tagaggaagacactaa
© 1998-2018