Dataset for CDS BHRF1 of organism Panine gammaherpesvirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q9IHR2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Panine gammaherpesvirus 1 GN=BHRF1 (length=576 residues).
atggcctattcaacaagggatatactgttagccctgtgtatgcgggacagttacgtgcatggaaatggatctttgcatcc
tgtgttggagctagcagcaagagaaacacctcctcgcgtttccccagaagatactgtggttttgcggttacatttgttgc
ttgaggaggtaattcagcaaaatgcagaatcatttacaaacacttgggagacatttataacaaacgctgaacacgtggac
ctggattttgccgctgtatttgaagatatatttcaccgtggagatccatcccttgggcgagcgttggcctggctggcctg
gtgtatgcatgcctgcaggacattgtgcaggaaccagaacactccttactatgttgtggacctgtcagttcgtgggatgt
tggaagccagcgaaggcctggatgcttggattcatcaacagggtggctggactggtctaattaggagcgactctcttggc
tccacaaactctagatggactttgctttttgccggactgactttgagtctgttaattgtatgtagctatttatttatctc
tagaggaagacactaa
© 1998-2018