Dataset for CDS herpesviridae of organism Ovine gammaherpesvirus 2

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A1BM64_A9-01 A9 gene OS=[Viruses] Ovine gammaherpesvirus 2 GN=A9 (length=621 residues).
atggtggaagctggcatactatcaaggaaagtaaccactgggagccactggactttcttcacccctcaaaccttgaagaa
aggggcttgcctgtggaaggctggggcagtatatttccccccagcaagcatgccccccaggaaggcattcaatgacgggg
acctgctttactttaacttcactagagagatacacatgctccttataaagagcggcattccctgtagctatgctaaaggc
atcatgagagctgccaggacaaaagccgtggactgcagctccaccttcgaggtgatagtggatggggtcggacacccctc
tcccgagtcactggaacggatagccaagtcgcttttcaccccacggcccaactggggtcgggttgtgatgttttttgcct
atttgttttacctgcaaataagctccacccagaaggttttttttcgggaccattacaagaagattgaaagcatcatagag
gcacatatagttccctggactctctcgcagcggaaactcaaggagccttttccactaaaaatgagggaagtggttatttt
tttcaccacagtggcgtccctggtagctatgcttctgttctgtagacgcgcgtggagctag
>gnl|bcl2dbcds|Q2VSG7_A9-01 A9 gene OS=[Viruses] Ovine gammaherpesvirus 2 GN=A9 (length=621 residues).
atggtggaagctggcatactatcaaggaaagtaaccactgggagccactggactttcttcaccccccaaaccttgaagaa
aggggcttgtctgtggaaggctggggcagtatatttccccccagtaagcatgccccccaggaaggcattcaatgacgggg
acctgctttactttaacttcactagagagatacacatgctccttataaagagcggcattccctgtagctatgctaaaggc
atcatgagagccgccaggacaaaagccgtggactgcagctccaccttcgaggtgatagtggatggggtcggacacccctc
tcccgagtcactggaacggatagccaagtcgctattcaccccacggcccaactggggtcgggttgtgatgttttttgcct
atttgttttacctgcaaataagctccacccagaaggttttttttcgggaccattacaagaagattgaaagcatcatagag
gcacatatagttccctggactctctcgcagcggaaactcaaggagccttttccactaaaaatgagggaagtggttatttt
tttcaccacagtggcgtccctggtagctatgcttctgttatgcagacgcgcgtggggctag
© 1998-2018