Dataset for CDS Unclassified of organism Osmerus mordax

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C1BL36_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Osmerus mordax (length=561 residues).
atgtcgtgtaggctgtggaaggagacactggctctgggagaagactacctggctttctgctgtgcaagcccacggctagc
ccctccccctcccagcgagccggcggctgccatgagacgtctggcacaggacatggagaccctgaacagcgtctccttcc
aagccctttccaagaacctcctgtgccactctgaacaggacccctgtgccagcctgagggcagtgctgaaagagatagtt
gtagatggaaaactgaactggggaagggtagtgtgcatcttcacctttactggtgtgctggccagacagctacaagagca
gaagtcaaaggggcaggacattgggcaagggcctgacaaatgcagaggcttggctgaggcgatcgctgacttcctgggag
aggagaagaaagactggctgcaggaaaatggaggctgggaagggctttgtaagttttcagattgtgccagagggatgaac
caagactcctccatgaagacggccctgtttgctgttgctggcgtgggcattgcagggttaacctttctcctggggcgcta
g
© 1998-2018