Dataset for CDS herpesviridae of organism Murine herpesvirus 72

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|B1PZP0_M11-01 M11 gene OS=[Viruses] Murine herpesvirus 72 GN=M11 (length=516 residues).
atgagtcataagaaaagcgggacttattgggcaaccctgattacagccttcttgaagactgtttctaaagtggaagaact
ggattgtgttgattctgctgtgttagttgatgtctctaaaataataacattgacccaggagtttagaaggcactatgaca
gcgtttaccgcgcggattatggccctgccctcaagaactggaaaagagacctgtccaaacttttcacctcgttgtttgta
gatgtcatcaacagtggaagaattgttggattttttgatgttggcagatatgtgtgtgaggaggtactatgtcccggcag
ttggacggaggatcatgaattattgaacgattgcatgacacacttttttattgaaaacaatttaatgaaccattttccat
tagaagacatatttttggcacagagaaaattccagaccactggctttacattcttgttgcatgccctggcgaaggtgttg
cccaggatatattctgggaatgtgatttatgtctga
© 1998-2018