Dataset for CDS Unclassified of organism Lymphocryptovirus Macaca pfe lcl E3

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0S0DWX8_uncBALF1-01 Putative BALF1 gene OS=[Viruses] Lymphocryptovirus Macaca/pfe-lcl-E3 (length=549 residues).
atgcagccagccaagtctaccgattcggtgtttgtgaggaccccggtcgaggcgtgggtctccccctcgcccccggacga
caaagtggcggaaaccagctacctcctgttcagggccatgtacgccgtgttcacccaggacgagacggacctgcctctac
cggccctggtcatgtgccggctcctgaaagcctccctgaggaagcacaggagaatgtacgcggagctggcctgcaagacg
gccgacctcgggggcaagcacgcgcacatgcagctcatcatcagcgtgctgagagccgtgtacgatgaccattacgacta
ctggtcgcggctcagggtggtgctgtgctacacggtggtgtttgcggtgcgcaactacctggatgaccacgacagcgccg
ccttcgtgatgggggccaccgcccactacctcgccctctatcgcaggctctggtttgcgagtctgggcggcctgccaagg
gcgctgagacgtcagttccccgtgacgtggaccgtggccagcctgagcaccttcctgaaatctttgtaa
© 1998-2018