Dataset for CDS Unclassified of organism Lepisosteus oculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5N753_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Lepisosteus oculatus (length=1593 residues).
atgtgtgaccaaacgtttctcgccatcaacttcgggccgtgtgacaaatgtcaaaagacaaagcccctgatgaatatata
catcaaatcggagccgatcaactactgcgcgctctgcgtggagctgatggctaccgaggggctgcaggagagtgagaccc
tggcatccttgaaaaacgagtcggagaccctgaagtcaaagctggaagaggagagagccaagctgcacgatgttgaacta
caccaggtggcggaccgggtggaggcgctgggtcagtttgtgatgaagaccaggcggaccctgaagggccacggaaacaa
agtgctgtgcatggactggtgtaaagacaagagaaggatcgtgagctcttcccaggatggaaaagtaattgtatgggatg
ctttcacaaccaacaaggaacatgcagtcaccatgccatgcacctgggtaatggcttgtgcgtacgcaccctctggctgt
gcagtagcctgtggaggtttggacaacaagtgttcagtgtatccattgacttttgacaagaatgagaacatggcttcaaa
gaagaagtctgtggcaatgcataccaactacttgtcagcctgcagcttcaccaactctgacatgcagatcctgacagcca
gtggagatggcacctgtgctctgtgggatgtggagagtggacagctgctccagagtttccacggccacgccgccgacgtg
ctctctctggacctggcgccgtcagagacgggcaacaccttcgtgtccgggggttgtgataagaaggccatggtctggga
cctgcgctctggacagtgcatccagtcctttgaaacacatgagtctgacattaacagcgtcagatactatcccagtggag
atgcatttgcatcaggttctgatgatgctacttgtcgtctgtacgatcttcgagcagacagagaagtagcaatttactcc
aaagaaagcatcatttttggagcttcaagcgtggacttttcacttagtggacgtctgctgtttgcaggatacaatgatta
cactattaatgtctgggatgtcctgaagggcaccagggtctccattctctttggtcatgagaatcgggttagcacattgc
gagtttcaccggatggcacagccttctgctctggatcatgggatcatactctgaggaaaatgagctgctgtttgagggaa
cagaccttgattctggctcgggattacatcgacctctgcctggggacgacccgccagtctcccagcccaaacgccgaagc
gatgcgcagtctggccaaggagatggagaagcagtaccagtccaaatttaactccctcctgcacagtttcatcgcgacgt
gcggacccgaccccagcgttaacttgaagaaggtcatggaggaactggtcggagacgggattttaaactgggggagggtg
gtttctctcttcaccttcacaggactgctggcacgccagctgtacgccgaaggagcgagtattgactgttttaagagact
ggccgaaacaattgctgactacctcggaggtgaaaaacgagaatggctgatacagaatgaaggatgggtaagt
© 1998-2018