Dataset for CDS vNR13 of organism Latimeria chalumnae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H3ALX7_vNR13-01 vNR13 gene OS=[Eukaryota] Latimeria chalumnae GN=vNR13 (length=537 residues).
atgtgcgattcgttgaaagaggaaacccgactcttggctaacgatttcatccagttttgcctcggcagcggccggactgc
ccccaaccctgcagcccgggtcctgcgcagggtgacagcggaactggagcggcagaaccaggcgctcttcgactcgtttc
aggggaactgtgggccggaggccgagctcggctcggtgctgaagagggtggctgagcagctggaggccgaaggcggcttg
aactgggggagggtggtgagtttatttgccttcgcgggctgcttggctaaaggggtccagcgggcccagaatgaggagtg
tgcgatgggagcctgctgtgggaagttggctgaagctctggttaactacctggccaaggaaagaggggactggctggagg
agaatggaggctgggatggattctacaaattttttgaaagaagtgatcattaccaggagtccactgtacgaaatgcttta
atggcagcagctgggtttggaatagcaggtttagccttcctgttagctgtgcgataa
© 1998-2018