Dataset for CDS Unclassified of organism Human herpesvirus 8

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A0N9SCW9_uncORF16-01 Putative ORF16 gene OS=[Viruses] Human herpesvirus 8 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcatgtggattaaacgaacctgagta
tctgtaccatcctttgctcagccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggctaatgtgagatttcacagcaccaccggtataaaccagcttgggttgagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactaacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgttattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgaccaggagatga
>gnl|bcl2dbcds|A0A0N9SEY2_uncORF16-01 Putative ORF16 gene OS=[Viruses] Human herpesvirus 8 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcctgtggattaaacgaacctgagta
tctgtaccatcctttgctcaaccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggcgaatgtgagatttcacagcaccaccggtataaaccagcttgggttaagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactaacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgttattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgaccaggagatga
© 1998-2018