Dataset for CDS herpesviridae of organism Human herpesvirus 8

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q76RI8_ORF16-01 ORF16 gene OS=[Viruses] Human herpesvirus 8 GN=ORF16 (length=528 residues).
atggacgaggacgttttgcctggagaggtgttggccattgaagggatattcatggcctgtggattaaacgaacctgagta
cctgtaccatcctttgctcagccctattaagctatacatcacaggcttaatgcgagacaaggagtctttattcgaggcca
tgttggctaatgtgagatttcacagcaccaccggtataaaccagcttgggttgagcatgctgcaggttagcggcgatgga
aacatgaactgggggcgagccctggctatactgacctttggcagttttgtggcccagaagttatccaacgaacctcacct
gcgagactttgctttggccgttttacctgtatatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaaggggacggagaatgacagcgctattgggaagcatt
gcattattggccactatattggcagcggtcgcgatgagcaggagataa
© 1998-2018