Dataset for CDS herpesviridae of organism Gorilline gammaherpesvirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q91HI3_BALF1-01 BALF1 gene OS=[Viruses] Gorilline gammaherpesvirus 1 GN=BALF1 (length=549 residues).
atgaggccggccaagtctacagattccgtgtttgtgaggaccccagtagaggcgtgggtcgcgccatcgcctccggacga
caaggtggcggagtccagctacctcatgttcagggcaatgtacgcggtgttcacccaggatgagacgggcctgcctctgc
cagccatggtcctgtgccggctgattaaggcgtccctgaagaaggacaagaagctgtacgcggagctggcctgcaagacg
gcggatatcgggggcaagcacgcgcacgtgcagctcatcatcagcgtcctgcgcgccgtgtacgacgaccactacgacta
ctggtcgcgtctcagggtcgtgttgtgctacacggtggtgtttgcggtgcgaaactacctggatgaccacgagagcgcgg
ccttcgttctgggggccatcgcccactacctggccctgtaccggagactctggtttgcgaggatgggcggcatgccaagg
tcgctgagacgtcagttccccgtgagatgggcgctggctggcctgacttacttcctgaaatctttgtaa
© 1998-2018