Dataset for CDS Unclassified of organism Gopherus agassizii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452I804_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Gopherus agassizii (length=441 residues).
gccgagacgctgcggcgggcggccagcgagctggagagccgggagcggcccttcttccgcgcctgccgcccgctggccct
ggacgagcgccaggagccggcggcgctgctgagccgcgtggcggagcagctggaggcggagggcggcctgaactggggcc
gggtgctggcgctggtggtgttcgcggggagcctggcggcggcgctggccgagcagggcagccgggaggaggcgggccgc
ttggccgaggtgctggcctcctacctggccgaggagaagcgcgagtggctggaggcgcacggcggctgggatggcttctg
tcacttcttcaatggacatggctctcaaccaactgaccagagcagtaccataagcagtgctatcatggcagcagcagggt
ttggactagcagggttagctgttctcttggctgtacgatag
© 1998-2019