Dataset for CDS Unclassified of organism Gallus gallus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|Q804D0_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Gallus gallus (length=534 residues).
atgccgggctctctgaaggaggagacggcgctgctgctggaggactacttccagcaccgcgccggcggcgccgcgctgcc
tcccagcgccacggcggccgagctgcggcgggcggcggccgagctggagcgccgagagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtggcggcgcagctggaggccgaaggcggc
ctcaactggggccggctgctggcgctcgtggtgttcaccggcacgctggcggcggcgctggccgagagcggctgcgagga
agggccgagccgcctggccgccgcgctggccgcgtacctggccgaggagcagggcgagtggcttgaggagcacgcgcgat
gggacggcttctgtcgcttcttcggcagacatggctcccaaccagctgaccagaacagtaccttaagcaatgccatcatg
gcagcggcagggtttggaatagcaggattagcttttctcttggtggtgcggtag
>gnl|bcl2dbcds|Q90ZN1_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Gallus gallus (length=534 residues).
atgccgggctctctgaaggaggagacggcgctgctgctggaggactacttccagcaccgcgccggcggcgccgcgctgcc
tcccagcgccacggcggccgagctgcggcgggcggcggccgagctggagcgccgagagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtggcggcgcagctggaggccgaaggcggc
ctcaactggggccggctgctggcgctcgtggtgttcaccggcacgctggcggcggcgctggccgagagcggctgcgagga
agggccgagccgcctggccgccgcgctggccgcgtacctggccgaggagcagggcgagtggctggaggagcacggcggat
gggacggcttctgtcgcttcttcggcagacatggctcccaaccagctgaccagaacagtaccttaagcaatgccatcatg
gcagcggcagggtttggaatagcaggattagcttttctcttggtggtgcggtag
© 1998-2018