Dataset for CDS Unclassified of organism Epstein Barr virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0B6VHH4_uncBHRF1-01 Putative BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus (length=297 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttggattcatcaac
agggcggctggtctacattaattgaagacaacattcctggatccagaaggtttagctggactttgtttcttgctggactg
actttgagtctgttagttatatgtagttatttatttatctccagaggaagacactaa
© 1998-2018