Dataset for CDS herpesviridae of organism Epstein Barr virus

[Download (right click)] [Alignment] [Repertoires]

70 sequence(s)

>gnl|bcl2dbcds|A0A075FCZ0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgaaacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A075FFB0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaggctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0B6VHG4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaaaatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctggc
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7SXB3_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttttaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7T306_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacatctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttctcgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7T6R4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacattttcagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttctcgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7T8J1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggatcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7T924_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaagtttagctggactttgtttctcgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7TJ32_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgaatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TK05_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggat
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaacccgtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7TLW1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggacctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TNT4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcacgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7TPI3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TQI4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggatatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtgccctgcatcc
tgtgttggagctagcagcaagagaaacacctccccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaaaatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaaaacaacattcctggc
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7TTN2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccacctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7TUX3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggcaagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TV67_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatagcccactacctggccctctatcgcagaatctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TWM2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgccttttgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7TX82_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgtatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0C7U1E2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcatcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaattcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttataaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttctcgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0S2YQS0_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcccattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtgtcctgcatcc
tgtgttggagctagcagcaagagaaacacctccccgcgtttcgccagaggacactgtagtgctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagatacatttacagaaacttgggacagatttataacacacaccgaacatttggac
ctggattttaactcaatatttttagagatatttcaccgtggagacccaagccgtgggcgcgcgttggcctggctggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccaggacactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggtggctggtctacattaattgaagacaacattcctggc
tccagaagctttagctggactttgtttcttgctggactgactttgagtctgttagttgtatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0S2YQW9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccatcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0S2YRE8_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagacttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0U3U737_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcggggacaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0U3UKR9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgaactggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcaggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0X8YIW3_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcgagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcagggcattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A0X9C4Q9_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataagacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2D1LYV4_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagatgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2D1LYW3_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgccttttgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggagattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4C5_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgatcatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4D6_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgcaaatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctggc
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4D9_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttgtagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttatctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4E3_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagttttataacacacaccgaacatgtggac
ctggattttaactcagtatttgtagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4F2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagaccccagccttgggtgcgcgttgacctggatggcctg
gggcatgcatgcctgttggaccttgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4F8_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtatcctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttgtagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4H8_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatgcttccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4I0_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggatatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtgccctgcatcc
tgtgttggagctagcagcaagagaaacacctccccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4I4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggttccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2H4Z4M5_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggttccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtattttttgagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MM94_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcattgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MMY2_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaatcacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MNB9_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tacagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MP06_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MQV1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MTH2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcatcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggcaagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MU91_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
tagggagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MV59_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgcccttgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MW70_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccggacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MWX4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttacaacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MX38_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttttaacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MXY9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactttcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
accctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MYK7_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctctgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1MZQ8_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattactctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N164_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgtgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaactttcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgcagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|A0A2S1N1Z2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaaccgggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacacggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N2H2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaaccgggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N3G0_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcatcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaattcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttctcgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacagtaa
>gnl|bcl2dbcds|A0A2S1N3U3_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcaacaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|G3CKQ0_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcaccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatttggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgtaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|K9UT94_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|K9UTF7_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttgtagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|K9UTN7_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|P03182_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggat
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|P0C6Z1_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
>gnl|bcl2dbcds|P0CK58_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|P0CK59_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q91HV2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagatgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|U5YUM6_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaagaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcagagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|V5KU29_BHRF1-02 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcagcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaactcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttcttgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacagtaa
>gnl|bcl2dbcds|V5KUE2_BHRF1-02 BamHI-H right reading frame gene OS=[Viruses] Epstein-Barr virus GN=BHRF1 (length=576 residues).
atggcctattcaacaagggagatactgttagccctgtgtatacgggacagtcgtgtgcatggaaatggtaccctgcatcc
tgtgttggagctagcatcaagagaaacacctctccgcctttcgccagaggacactgtagttctgcgttatcatgtgttgc
ttgaggagataattgaacgaaattcagagacatttacagaaacttggaacagatttataacacacaccgaacatgtggac
ctggattttaattcagtatttttagagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggatggcctg
gtgcatgcatgcctgcaggacattgtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
tagaagccagcgaaggcctggatggttggattcatcaacagggcggctggtctacattaattgaagacaacattcctgga
tccagaaggtttagctggactttgtttctcgctggactgactttgagtctgttagttatatgtagttatttatttatctc
cagaggaagacactaa
© 1998-2018