Dataset for CDS BALF1 of organism Epstein Barr virus

[Download (right click)] [Alignment] [Repertoires]

27 sequence(s)

>gnl|bcl2dbcds|A0A075FCZ0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgaaacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A075FFB0_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaggctgtacgcagagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7T8J1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggatcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TJ32_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgaatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TLW1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggacctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TPI3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TUX3_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggcaagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0C7TV67_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatagcccactacctggccctctatcgcagaatctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0S2YQW9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccatcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0U3U737_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcggggacaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A0U3UKR9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgaactggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcaggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2D1LYV4_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagatgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MM94_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcattgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MP06_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MQV1_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MTH2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcatcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggcaagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MU91_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
tagggagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MV59_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgcccttgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MXY9_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactttcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
accctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1MZQ8_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattactctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N1Z2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaaccgggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacacggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|A0A2S1N2H2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaaccgggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagagccatgtacgcg
gtgttcgcccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|K9UT94_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=549 residues).
atgaggccagccaagtctacagattctgtgtttgtgaggaccccggtcgaggcgtgggtcgcgccctcgccgccggacga
caaggtggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacccgggatgagaaagacctgcctttgc
cagccctggtcctctgccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcaggaca
gccgacatcgggggcaaagacacgcacgtacggctcatcatcagcgtcctgcgcgcagtgtacaacgaccactacgacta
ctggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatgaccacaagagcgccg
ccttcgtgctgggggcaatcgcccactacctggccctctatcgcagactctggtttgcgaggctgggcggcatgccaaga
tcgctgagacgtcagttccccgtgacgtgggccctggccagcctgactgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|P0CK58_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|P0CK59_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|Q91HV2_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaggaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcggagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagatgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
>gnl|bcl2dbcds|U5YUM6_BALF1-01 BALF1 gene OS=[Viruses] Epstein-Barr virus GN=BALF1 (length=663 residues).
atgaacctggccattgctctggactctcctcacccaggcctcgcgtcttatactattctgccacgcccattttatcatat
aagcctgaagcccgtgagctggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtgaagaccccgg
tcgaggcgtgggtcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatgttcagggccatgtacgcg
gtgttcacccgggatgagaaagacctgcctttgccagccctggtcctctgccggctcatcaaggcctccctgaggaagga
taggaagctgtacgcagagctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagggtggtgctgtgctacacagtggtgtttgcg
gtgcgaaactacctggatgaccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccctctatcgcag
actctggtttgcgaggctgggcggcatgccaagatcgctgagacgtcagttccccgtgacgtgggccctggccagcctga
ctgacttcctgaaatctttgtaa
© 1998-2018