Dataset for CDS Unclassified of organism Danio rerio

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q8UWD5_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Danio rerio (length=531 residues).
atgtcctgttggttgagggaacagactctgttgctggcggaggactacatcagcttctgcagtgggatccaacagacgcc
tcccagcgagtcggcggaggccatgaggtacctggccaaagaaatggagcagcagcacagaaccaaattccgatcccttt
cccaggagttcctggacacctgcggagcagatcccagcaaatgtctgcagagcgtcatgagagaactggtgggagatggg
aaaatgaactggggaagggtggtctctatcttcacattcactggagtgctggccagtgaactactgtccaggggagagaa
ttcggagggttcccgaagattggccgagactatagcagactacctaggaggagaaaaacaggactggctggtggaaaacg
gaggctgggagggtttttgcaggtttttccacaacgcaagacaactgaaccaggagtcctccatgaaaacagcactgttt
gcagcagcaggagtgggtttagctggtctaaccttcctcttagtacgctga
© 1998-2018