Dataset for CDS Unclassified of organism Cricetid gammaherpesvirus 2

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E9M5Q5_uncM11-01 Putative M11 gene OS=[Viruses] Cricetid gammaherpesvirus 2 (length=519 residues).
atggacaatctgacagagtggcgatcccttctgaaagtgtttctgcttaaatcaagtgggtgtagctgtcaaggcgtgtc
agctggtttgttggcggatgtggatgttttggacaaactcactacagattttataactaagtatgaatcggtgtatggaa
aattgcccctgactcagtcagattgggtaaacaatataactgctttgttattttttatgttggacaagataaactttggg
agatttattggtttgtttgctgttggcaaatttgtgtgtcaggaactgctgctgtcctctaccacatggtctatggcaca
tgacctgctttttcataaactggccctggtattggaagtaaagattatgccatggttgaccagcatgggcgtgggcacct
ttaatgagttgctaggaagacacgcgggacaagttgttcaaacaagattcttttattttttaaaatcaatgtttgtatgg
gcatgtatgcagttgttggatccatggccttttacctaa
© 1998-2018